Review



pb9008  (Boster Bio)


Bioz Verified Symbol Boster Bio is a verified supplier
Bioz Manufacturer Symbol Boster Bio manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    Boster Bio pb9008
    Pb9008, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pb9008/Anti-P53%2FTP53+Antibody+Picoband/pm41707646-436-37-35
    Average 91 stars, based on 51 article reviews
    pb9008 - by Bioz Stars, 2026-10
    91/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: A conserved eIF1A + luminal cell-centered hypoxic and "cold" tumor microenvironment promotes pan-subtype prostate cancer progression.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibody Anti-CD44 (IMC) Abcam Cat# ab6124; RRID: AB_305297 Anti-AR (IMC) Boster Cat# A00542; RRID: AB_3081165 Anti-IDH1 (IMC) Abcam Cat# ab242078 Anti-HLA I (IMC) Abcam Cat# ab239788; RRID: AB_3665873 Anti-TP53 (IMC) Boster Cat# PB9008; RRID: AB_3082963 Anti-CK5 (IMC) Boster Cat# M00398-7; RRID: AB_3081774 Anti-Collagen I (IMC) abcam Cat# ab215969; RRID: AB_2909621 Anti-CASP3 (IMC) Cell Signaling Technology Cat# 94530; RRID: AB_3076239 Anti-CD31 (IMC) Cell Signaling Technology Cat# 85873SF Anti-E-cadherin (IMC) Abcam Cat# ab256580 Anti-HIF-1a (IMC) Abcam Cat# ab210073 Anti-CD45 (IMC) Cell Signaling Technology Cat# 47937; RRID: AB_2922773 Anti-IDH2 (IMC) Abcam Cat# ab230796 Anti-CD163 (IMC) Abcam Cat# ab215976; RRID: AB_3717832 Anti-IDO-1 (IMC) Proteintech Cat# 66528-1-Ig; RRID: AB_2881891 Anti-PD-L1 (IMC) Abcam Cat# ab226766; RRID: AB_3073663 Anti-VEGFA (IMC) Abcam Cat# ab185238 Anti-CD68 (IMC) Biolegend Cat# 916104; RRID: AB_2616797 Anti-PSMA (IMC) Sino biological Cat# 201427-T10 Anti-CD20 (IMC) Abcam Cat# ab213033 Anti-PTEN (IMC) Sino biological Cat# 100729-T08 Anti-CK8 (IMC) Boster Cat# M01421-3 Anti-SF3B1 (IMC) Abcam Cat# ab249538 Anti-PD-1 (IMC) Cell Signaling Technology Cat# 63815; RRID: AB_3675993 Anti-Ki-67 (IMC) BD Cat# 550609; RRID: AB_393778 Anti-FBP1 (IMC) Abcam Cat# ab247749 Anti-HLA-DR (IMC) Abcam Cat# NB600-989 Anti-eIF1A (IMC) Abcam Cat# ab243919 Anti-CD3 (IMC) Cell Signaling Technology Cat# 24581SF Anti-FAP (IMC) Abcam Cat# ab271976; RRID: AB_3676372 Anti-c-MYC (IMC) Abcam Cat# ab264603 Anti-CD29/Integrin beta 1 (IMC) Abcam Cat# ab271931 Anti-HMGCR (IMC) Boster Cat# A00643-3 Anti-ACC (IMC) Abcam Cat# ab173584 Anti-Pan-cytokeratin (IMC) Biolegend Cat# 914204, RRID: AB_2616960 Anti-aSMA (IMC) Biolegend Cat# 904601, RRID: AB_2565041 Anti-BRCA1 (IMC) Boster Cat# PB9015, RRID: AB_3082969 Anti-Vimentin (IMC) Abcam Cat# ab193555, RRID: AB_2814713 Anti-eIF1A (WB and IF) Proteintech Cat# 11649-2-AP; RRID: AB_2097803 Anti-HIF-1α (WB and IF) Cell Signaling Technology Cat# 14179, RRID: AB_2622225 Anti-β-actin (WB) Proteintech Cat# 66009-1-Ig; RRID: AB_2687938 Anti-CA9 (IF) Proteintech Cat# 11071-1-AP; RRID: AB_2066528 Anti-CD3 (IF) Abcam Cat# ab16669; RRID: AB_443425 (Continued on next page) e1 Cell Reports Medicine 7, 102619, February 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Anti-CD68 (IF) Affinity biosciences Cat# DF7518; RRID: AB_2841017 Anti-human CD8A (IF) Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-human CD31 (IF) Proteintech Cat# 11265-1-AP; RRID: AB_2299349 Anti-p63 (IF) Proteintech Cat# 12143-1-AP, RRID:AB_10597397 Anti-collagen-I (IF) Proteintech Cat# 67288-1-Ig, RRID:AB_2882554 InVivoMAb mouse IgG1 isotype control Bio X cell Cat# BE0083 InVivoPlus Anti-mouse CD3ε Bio X cell Cat# BP0001-1 Gene primer Sense Antisense human-EIF1A CCGCTACCCGGAAAGAAGT AGCTTTGTTATCCTGGTAGTCTCG human-HIF1A CTGAGGGGACAGGAGGA CACACGCGGAGAAGAGA human-β actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT mouse-EIF1A TGCGGATTATTACCCGATTCAGT GAAGATCCACAGGCAGCAAACA mouse-HIF1A AACCCATTCCTCATCCGTCAA CCGGCTCATAACCCATCAACT mouse-β actin GTGACGTTGACATCCGTAAAGA GTAACAGTCCGCCTAGAAGCAC siRNA and shRNA si-EIF1A GAGGUUAUGUCACAUCAGATT UCUGAUGUGACAUAACCUCTT si-HIF1A GGGAUUAACUCAGUUUGAATT UUCAAACUGAGUUAAUCCCTT si-NC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT sh-EIF1A GATCCGATGTTGAGTTATCATCTTAACTCGAG TTAAGATGATAACTCAACATCTTTTTT AATTAAAAAAGATGTTGAGTTAT CATCTTAACTCGAGTTAAGATG ATAACTCAACATCG sh-NC GATCTGTTCTCCGAACGTGTCACGTTTCAAGA GAACGTGACACGTTCGGAGAATTTTTTC AATTGAAAAAATTCTCCGAACG TGTCACGTTCTCTTGAAACGTG ACACGTTCGGAGAACA Critical Reagent RNA extraction kit Takara Kusatsu Cat# 9767 Hiscript II First-Strand cDNA Synthesis Kit Vazyme Biotech Cat# R211 MonAmp SYBR Green qPCR Mix Monad Biotech Cat# MQ10101S RIPA lysis buffer KeyGene Biotech Cat# KGB5203-100 BCA Protein Assay Kit Thermo Scientific Cat# 23225 SYBR Green Thermo Scientific Cat# 4368577 RPMI 1640 medium Thermo Scientific Cat# C11875500BT DMEM medium Thermo Scientific Cat# C11995500BT Fetal bovine serum Suzhou Shuangru Biotechnology CO.td Cat# LONSERA/S711-001S MACS Tissue Storage Solution Miltenyi Cat# 130-100-008 Phosphate buffered saline (PBS) Hyclone Cat# SH30256.01 Collagenase Type II Sigma Cat# V900892 Collagenase Type IV Sigma Cat# C5138 Dispase II Roche Cat# 4942078001 Fetal bovine serum (FBS) Gibco Cat# 10100147C 6-Colour IHC kit for human Absin Cat# abs50014 6-Colour IHC kit for mouse Absin Cat# abs50030 CoCl 2 Macklin Cat# C885204 Cell Counting Kit-8 TargetMol Cat# C0005 Degarelix Acetate TargetMol Cat# 934016-19-0 Homoharringtonine TargetMol Cat# 26833-87-4 Experimental models 293T cell American Type Culture Collection (ATCC, USA) N/A (Continued on next page) Cell Reports Medicine 7, 102619, February 17, 2026 e2



    Similar Products

    pb9008  (Boster Bio)
    91
    Boster Bio pb9008
    Pb9008, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pb9008/Anti-P53%2FTP53+Antibody+Picoband/pm41707646-436-37-35
    Average 91 stars, based on 1 article reviews
    pb9008 - by Bioz Stars, 2026-10
    91/100 stars
    		  Buy from Supplier
    primary antibodies against p53  (Boster Bio)
    91
    Boster Bio primary antibodies against p53
    Primary Antibodies Against P53, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pb9008/Anti-P53%2FTP53+Antibody+Picoband/pm41596481-277-5-10
    Average 91 stars, based on 1 article reviews
    primary antibodies against p53 - by Bioz Stars, 2026-10
    91/100 stars
    		  Buy from Supplier
    p53  (Boster Bio)
    91
    Boster Bio p53
    SeGL reduces inflammatory damage in the testicles of roosters by inhibiting the activation of the <t>NF-κB-p53</t> signaling pathway. A-B. Relative mRNA expression of NF-κB and p53 in the testes of the control, LSe, MSe, or HSe group (n = 3). C . Western blot of NF-κB and p53 proteins in the testes of each group. d -E . Quantitative analysis of NF-κB and <t>p53</t> <t>protein</t> expression in the testes of each group (n = 3). Data are presented as means ± SD; Different lowercase letters indicate significant differences between groups (P < 0.05).
    P53, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pb9008/Anti-P53%2FTP53+Antibody+Picoband/pmc12723041-86-57-59
    Average 91 stars, based on 1 article reviews
    p53 - by Bioz Stars, 2026-10
    91/100 stars
    		  Buy from Supplier
    β actin  (Boster Bio)
    91
    Boster Bio β actin
    SeGL reduces inflammatory damage in the testicles of roosters by inhibiting the activation of the <t>NF-κB-p53</t> signaling pathway. A-B. Relative mRNA expression of NF-κB and p53 in the testes of the control, LSe, MSe, or HSe group (n = 3). C . Western blot of NF-κB and p53 proteins in the testes of each group. d -E . Quantitative analysis of NF-κB and <t>p53</t> <t>protein</t> expression in the testes of each group (n = 3). Data are presented as means ± SD; Different lowercase letters indicate significant differences between groups (P < 0.05).
    β Actin, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pb9008/Anti-P53%2FTP53+Antibody+Picoband/pm35412829-17-2-27
    Average 91 stars, based on 1 article reviews
    β actin - by Bioz Stars, 2026-10
    91/100 stars
    		  Buy from Supplier
    pb9008/bm0101  (Boster Bio)
    90
    Boster Bio pb9008/bm0101
    SeGL reduces inflammatory damage in the testicles of roosters by inhibiting the activation of the <t>NF-κB-p53</t> signaling pathway. A-B. Relative mRNA expression of NF-κB and p53 in the testes of the control, LSe, MSe, or HSe group (n = 3). C . Western blot of NF-κB and p53 proteins in the testes of each group. d -E . Quantitative analysis of NF-κB and <t>p53</t> <t>protein</t> expression in the testes of each group (n = 3). Data are presented as means ± SD; Different lowercase letters indicate significant differences between groups (P < 0.05).
    Pb9008/Bm0101, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pb9008/pb9008%2Fbm0101/boster+bio___pb9008%2Fbm0101
    Average 90 stars, based on 1 article reviews
    pb9008/bm0101 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    SeGL reduces inflammatory damage in the testicles of roosters by inhibiting the activation of the NF-κB-p53 signaling pathway. A-B. Relative mRNA expression of NF-κB and p53 in the testes of the control, LSe, MSe, or HSe group (n = 3). C . Western blot of NF-κB and p53 proteins in the testes of each group. d -E . Quantitative analysis of NF-κB and p53 protein expression in the testes of each group (n = 3). Data are presented as means ± SD; Different lowercase letters indicate significant differences between groups (P < 0.05).

    Journal: Poultry Science

    Article Title: Effect of selenium-enriched Ganoderma lucidum powder in testicular tissues, oxidative stress biomarkers and antiapoptotic capacities in roosters

    doi: 10.1016/j.psj.2025.106185

    Figure Lengend Snippet: SeGL reduces inflammatory damage in the testicles of roosters by inhibiting the activation of the NF-κB-p53 signaling pathway. A-B. Relative mRNA expression of NF-κB and p53 in the testes of the control, LSe, MSe, or HSe group (n = 3). C . Western blot of NF-κB and p53 proteins in the testes of each group. d -E . Quantitative analysis of NF-κB and p53 protein expression in the testes of each group (n = 3). Data are presented as means ± SD; Different lowercase letters indicate significant differences between groups (P < 0.05).

    Article Snippet: After blocking with 5 % non-fat milk (A600669, Sangon, Shanghai, China) in TBST (Tris-buffered saline with 0.1 % Tween-20) for 1 h at room temperature, membranes were incubated overnight at 4°C with primary antibodies against target proteins [Bax (50599-2-lg, Proteintech, Wuhan, China), Bcl-2 (26593-1-AP, Proteintech, Wuhan, China), Caspase3 (PB9188, Boster, Wuhan, China), NF-κB (PB9149, Boster, Wuhan, China), p53 (PB9008, Boster, Wuhan, China), StAR (A00051-1, Boster, Wuhan, China), Cyp11a1 (BA3699, Boster, Wuhan, China), Hsd3b1 (A02856-2, Boster, Wuhan, China)] and β-tubulin (internal control; bsm-33034 M, Bioss Antibodies, Beijing, China).

    Techniques: Activation Assay, Expressing, Control, Western Blot